Optimized CRISPR Design Tool by Feng Zhang group

The CRISPR design tool is a web tool developed by Feng Zhnag group at MIT to help researchers in designing CRISPR guide RNA in an input DNA sequence by (i) discovering possible offtargets genome-wide, (ii) highlighting guides with high target specificity, and (iii) flagging guides with numerous or genic offtargets in target genomes. Currently, there are 15 target genomes to choose for the target design.

There are two steps to design a suitable target

1) Enter a 23-500 bp long sequence

2) Choose a target genome, and click submit

You can also submit multiple sequences in fasta format using a batch mode.

The sequence will be scanned for possible CRISPR guides (20 nucleotides followed by a PAM sequence: NGG) and scanned for possible offtarget matches throughout the selected genome. Job output will be presented on the job output page with each guide linked to a list of offtargets and presented in the order of their score from zero to 100% roughly indicating the faithful on-target activity of each guide.

Results can be downloaded in genbank file format and all off-targets can be downloaded in csv format.

Screen Shot 2014-02-01 at 9.49.44 PM

 

Edit: This tool can also be used to design  guide pairs for nickase cas9.

Subscribe CRISPR-cas Updates

Share This Article

You might also like

One Response to "Optimized CRISPR Design Tool by Feng Zhang group"

  1. B2M says:

    >NG_012920.1:5001-5127 Homo sapiens beta-2-microglobulin (B2M), RefSeqGene on chromosome 15
    AATATAAGTGGAGGCGTCGCGCTGGCGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCT
    CCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGC

Leave a Reply

Submit Comment

© 2018 CRISPR tools and Resources. All rights reserved.
%d bloggers like this: